Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T2448
Clone ID E2448
Template ID T2448
Template Origin Plasmid
Clone Image 1247001
Validity OK
Gene symbol Dnajc4
Gene description DnaJ (Hsp40) homolog, subfamily C, member 4 (Dnajc4)
Gene Aliases Hspf2, Mcg18, 2010301J22Rik
MGI ID MGI:1927346
Entrez Gene ID 57431
Ref Seq Accession NM_020566
Chromosome Location 19
ENSEMBL Transcript ID ENSMUST00000025915
ENSEMBL Gene ID ENSMUSG00000024963
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 27
Template Well F04
Template Group  
Template Sequence Status Partial
Template Sequence ID 1247001_r1AA839121AI
TGU M
 Template Sequence