Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T2432
Clone ID E2432
Template ID T2432
Template Origin Plasmid
Clone Image 1244271
Validity OK
Gene symbol Gdpd1
Gene description glycerophosphodiester phosphodiesterase domain containing 1 (Gdpd1)
Gene Aliases 2610020H15Rik
MGI ID MGI:1913819
Entrez Gene ID 66569
Ref Seq Accession NM_025638
Chromosome Location 11
ENSEMBL Transcript ID ENSMUST00000020804
ENSEMBL Gene ID ENSMUSG00000061666
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 27
Template Well D12
Template Group  
Template Sequence Status Partial
Template Sequence ID 1244271_r1AA790808AI
TGU M
 Template Sequence