Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T2428
Clone ID E2428
Template ID T2428
Template Origin Plasmid
Clone Image 1243648
Validity OK
Gene symbol Zcchc7
Gene description zinc finger, CCHC domain containing 7 (Zcchc7)
Gene Aliases D4Wsu132e
MGI ID MGI:2442912
Entrez Gene ID 28027
Ref Seq Accession NM_138590
Chromosome Location 4
ENSEMBL Transcript ID ENSMUST00000067521
ENSEMBL Gene ID ENSMUSG00000054444
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 27
Template Well D08
Template Group  
Template Sequence Status Partial
Template Sequence ID 1243648_r1AA789837AI
TGU M
 Template Sequence