Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T2427
Clone ID E2427
Template ID T2427
Template Origin Plasmid
Clone Image 1243623
Validity OK
Gene symbol Topbp1
Gene description topoisomerase (DNA) II beta binding protein (Topbp1)
Gene Aliases mKIAA0259, 2810429C13Rik, D430026L04Rik
MGI ID MGI:1920018
Entrez Gene ID 235559
Ref Seq Accession NM_176979
Chromosome Location 9
ENSEMBL Transcript ID ENSMUST00000035164
ENSEMBL Gene ID ENSMUSG00000032555
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 27
Template Well D07
Template Group  
Template Sequence Status Partial
Template Sequence ID 1243623_r1AA789826AI
TGU M
 Template Sequence