Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T2424
Clone ID E2424
Template ID T2424
Template Origin Plasmid
Clone Image 1243299
Validity OK
Gene symbol Siglec10
Gene description sialic acid binding Ig-like lectin 10
Gene Aliases 9830164H23, A630096C01Rik, mSiglec-G
MGI ID MGI:2443630
Entrez Gene ID 243958
Ref Seq Accession NM_172900
Chromosome Location 7
ENSEMBL Transcript ID ENSMUST00000005592
ENSEMBL Gene ID ENSMUSG00000030468
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 27
Template Well D04
Template Group  
Template Sequence Status Partial
Template Sequence ID 1243299_r1AA764005AI
TGU M
 Template Sequence