Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T2423
Clone ID E2423
Template ID T2423
Template Origin Plasmid
Clone Image 1230943
Validity OK
Gene symbol Fgd4
Gene description FYVE, RhoGEF and PH domain containing 4 (Fgd4), transcript variant alpha
Gene Aliases Frabp, ZFYVE6, 9330209B17Rik
MGI ID MGI:2183747
Entrez Gene ID 224014
Ref Seq Accession NM_139232
Chromosome Location 16
ENSEMBL Transcript ID ENSMUST00000069284
ENSEMBL Gene ID ENSMUSG00000022788
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 27
Template Well D03
Template Group  
Template Sequence Status Partial
Template Sequence ID 1230943_r1AA790443BX
TGU M
 Template Sequence