Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T2404
Clone ID E2404
Template ID T2404
Template Origin Plasmid
Clone Image 1225336
Validity OK
Gene symbol Panx1
Gene description pannexin 1 (Panx1)
Gene Aliases  
MGI ID MGI:1860055
Entrez Gene ID 55991
Ref Seq Accession NM_019482
Chromosome Location 9
ENSEMBL Transcript ID NA
ENSEMBL Gene ID NA
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 27
Template Well B08
Template Group  
Template Sequence Status Partial
Template Sequence ID 1225336_r1AA764114AI
TGU M
 Template Sequence