Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T2402
Clone ID E2402
Template ID T2402
Template Origin Plasmid
Clone Image 1225022
Validity OK
Gene symbol Pcdh21
Gene description protocadherin 21 (Pcdh21)
Gene Aliases Prcad
MGI ID MGI:2157782
Entrez Gene ID 170677
Ref Seq Accession NM_130878
Chromosome Location 14
ENSEMBL Transcript ID ENSMUST00000022337
ENSEMBL Gene ID ENSMUSG00000021803
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 27
Template Well B06
Template Group  
Template Sequence Status Partial
Template Sequence ID 1225022_r1AA709790BX
TGU M
 Template Sequence