Eurexpress II Home Page
Image
 
Image
  Home > Database > Keyword Search
Image
Image Image  
  • Search by
  Keyword
  Sequence
  Anatomy
  • Partners
  EMAGE
  GenePaint
 
 
 
Image Image
 
 
 
  View Template Information

EURExpress Template ID: T2381
Clone ID E2381
Template ID T2381
Template Generating Unit M
Plate 26
Well H09
Clone image 1194056
Gene symbol Bace2
Gene description beta-site APP-cleaving enzyme 2 (Bace2)
Aliases ARP1, BAE2, DRAP, AEPLC, ALP56, ASP21, CDA13, CEAP1, 1110059C24Rik
Entrez gene ID 56175
Entrez ID version  
mRNA reference sequence NM_019517
Entrez accession ID version  
ENSEMB transcript ID ENSMUST00000047275
Transcript version 29
ENSEMB gene ID ENSMUSG00000040605
Gene version 29
Template status HOLD
Working reference  
Sequence Status  
Plasmid name pT7T3D-PacI
Promoter to generate antisense probe T3
Antisense promoter primer sequence AATTAACCCTCACTAAAGGGAGA
Forward and reverse primers position  
Forward and reverse primer sequences  
Sequence
 

Web page contact:
Copyright © 1994-2006. All Rights Reserved.