Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T2286
Clone ID E2286
Template ID T2286
Template Origin Plasmid
Clone Image 1097474
Validity OK
Gene symbol Apg10l
Gene description autophagy 10-like (S. cerevisiae) (Apg10l)
Gene Aliases APG10, Agp10, Apg10p, 5330424L23Rik, 5430428K15Rik
MGI ID MGI:1914045
Entrez Gene ID 66795
Ref Seq Accession NM_025770
Chromosome Location 13
ENSEMBL Transcript ID ENSMUST00000022119
ENSEMBL Gene ID ENSMUSG00000021619
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 25
Template Well H10
Template Group  
Template Sequence Status Partial
Template Sequence ID 1097474_r1AA869157AI
TGU M
 Template Sequence