Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T2237
Clone ID E2237
Template ID T2237
Template Origin Plasmid
Clone Image 1050498
Validity OK
Gene symbol Atp6ap1
Gene description ATPase, H+ transporting, lysosomal accessory protein 1 (Atp6ap1)
Gene Aliases 16A, CF2, ORF, AC45, C7-1, XAP-3, Atp6s1, VATPS1, Atp6ip1, FLJ00383, mFLJ00383
MGI ID MGI:109629
Entrez Gene ID 54411
Ref Seq Accession NM_018794
Chromosome Location X
ENSEMBL Transcript ID ENSMUST00000019231
ENSEMBL Gene ID ENSMUSG00000019087
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 25
Template Well D09
Template Group  
Template Sequence Status Partial
Template Sequence ID 1050498_r1AA592497AI
TGU M
 Template Sequence