Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T2233
Clone ID E2233
Template ID T2233
Template Origin Plasmid
Clone Image 1025328
Validity OK
Gene symbol 2810429K17Rik
Gene description RIKEN cDNA 2810429K17 gene (2810429K17Rik)
Gene Aliases 4833414G15Rik
MGI ID MGI:1924291
Entrez Gene ID 77041
Ref Seq Accession NM_029847
Chromosome Location 13
ENSEMBL Transcript ID NA
ENSEMBL Gene ID NA
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 25
Template Well D05
Template Group  
Template Sequence Status Partial
Template Sequence ID 1025328_r1AA590079AI
TGU M
 Template Sequence