Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T2232
Clone ID E2232
Template ID T2232
Template Origin Plasmid
Clone Image 1025049
Validity OK
Gene symbol Mtf1
Gene description metal response element binding transcription factor 1 (Mtf1)
Gene Aliases MTF-1
MGI ID MGI:101786
Entrez Gene ID 17764
Ref Seq Accession NM_008636
Chromosome Location 4
ENSEMBL Transcript ID ENSMUST00000030723
ENSEMBL Gene ID ENSMUSG00000028890
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 25
Template Well D04
Template Group  
Template Sequence Status Partial
Template Sequence ID 1025049_r1AA591190AI
TGU M
 Template Sequence