Eurexpress II Home Page
Image
 
Image
  Home > Database > Keyword Search
Image
Image Image  
  • Search by
  Keyword
  Sequence
  Anatomy
  • Partners
  EMAGE
  GenePaint
 
 
 
Image Image
 
 
 
  View Template Information

EURExpress Template ID: T2204
Clone ID E2204
Template ID T2204
Template Generating Unit M
Plate 25
Well A12
Clone image 920594
Gene symbol Ddx41
Gene description DEAD (Asp-Glu-Ala-Asp) box polypeptide 41 (Ddx41)
Aliases ABS, 2900024F02Rik
Entrez gene ID 72935
Entrez ID version  
mRNA reference sequence NM_134059
Entrez accession ID version  
ENSEMB transcript ID  
Transcript version 29
ENSEMB gene ID  
Gene version 29
Template status OK
Working reference  
Sequence Status  
Plasmid name pT7T3D-PacI
Promoter to generate antisense probe T3
Antisense promoter primer sequence AATTAACCCTCACTAAAGGGAGA
Forward and reverse primers position  
Forward and reverse primer sequences  
Sequence
 

Web page contact:
Copyright © 1994-2006. All Rights Reserved.