Eurexpress II Home Page
Image
 
Image
  Home > Database > Keyword Search
Image
Image Image  
  • Search by
  Keyword
  Sequence
  Anatomy
  • Partners
  EMAGE
  GenePaint
 
 
 
Image Image
 
 
 
  View Template Information

EURExpress Template ID: T2187
Clone ID E2187
Template ID T2187
Template Generating Unit M
Plate 24
Well H07
Clone image 902168
Gene symbol Tpt1p
Gene description Tpt1 pseudogene (Tpt1p) on chromosome 6.
Aliases tumor protein, translationally-controlled 1 pseudogene
Entrez gene ID 497210
Entrez ID version  
mRNA reference sequence NR_002218
Entrez accession ID version  
ENSEMB transcript ID  
Transcript version 29
ENSEMB gene ID  
Gene version 29
Template status OK
Working reference  
Sequence Status  
Plasmid name pT7T3D-PacI
Promoter to generate antisense probe T3
Antisense promoter primer sequence AATTAACCCTCACTAAAGGGAGA
Forward and reverse primers position  
Forward and reverse primer sequences  
Sequence
 

Web page contact:
Copyright © 1994-2006. All Rights Reserved.