Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T210
Clone ID E210
Template ID T210
Template Origin Plasmid
Clone Image 2648754
Validity OK
Gene symbol 4632417N05Rik
Gene description RIKEN cDNA 4632417N05 gene (4632417N05Rik)
Gene Aliases  
MGI ID MGI:1921282
Entrez Gene ID 74032
Ref Seq Accession NM_028725
Chromosome Location 8
ENSEMBL Transcript ID ENSMUST00000054941
ENSEMBL Gene ID ENSMUSG00000034308
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate 3
Template Well C09
Template Group  
Template Sequence Status Partial
Template Sequence ID 2648754_r1AW211301BX
TGU M
 Template Sequence