Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T2094
Clone ID E2094
Template ID T2094
Template Origin Plasmid
Clone Image 850085
Validity OK
Gene symbol Fbxl8
Gene description F-box and leucine-rich repeat protein 8 (Fbxl8)
Gene Aliases FBL8
MGI ID MGI:1354697
Entrez Gene ID 50788
Ref Seq Accession NM_015821
Chromosome Location 8
ENSEMBL Transcript ID ENSMUST00000036221
ENSEMBL Gene ID ENSMUSG00000033313
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 23
Template Well H10
Template Group  
Template Sequence Status Partial
Template Sequence ID 850085_r1AI613645BX5
TGU B
 Template Sequence