Eurexpress II Home Page
  Home > Database > Keyword Search
Image Image  
  • Search by
  • Partners
Image Image
  View Template Information

EURExpress Template ID: T208
Clone ID E208
Template ID T208
Template Generating Unit M
Plate 3
Well C07
Clone image 2648746
Gene symbol  
Gene description  
Entrez gene ID 0
Entrez ID version  
mRNA reference sequence  
Entrez accession ID version  
ENSEMB transcript ID  
Transcript version 29
ENSEMB gene ID  
Gene version 29
Template status HOLD
Working reference  
Sequence Status  
Plasmid name pCMV-SPORT6
Promoter to generate antisense probe T7
Antisense promoter primer sequence TAATACGACTCACTATAGGGAGA
Forward and reverse primers position  
Forward and reverse primer sequences  

Web page contact:
Copyright © 1994-2006. All Rights Reserved.