Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T2068
Clone ID E2068
Template ID T2068
Template Origin Plasmid
Clone Image 821031
Validity OK
Gene symbol 0610010F05Rik
Gene description RIKEN cDNA 0610010F05 gene (0610010F05Rik)
Gene Aliases mKIAA1841
MGI ID MGI:1918925
Entrez Gene ID 71675
Ref Seq Accession NM_027860
Chromosome Location 11
ENSEMBL Transcript ID ENSMUST00000043356
ENSEMBL Gene ID ENSMUSG00000042208
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 23
Template Well F08
Template Group  
Template Sequence Status Partial
Template Sequence ID 821031_r1AA647168BX5
TGU B
 Template Sequence