Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T2040
Clone ID E2040
Template ID T2040
Template Origin Plasmid
Clone Image 762540
Validity OK
Gene symbol 2810037C14Rik
Gene description RIKEN cDNA 2810037C14 gene (2810037C14Rik)
Gene Aliases Svh
MGI ID MGI:1914461
Entrez Gene ID 67211
Ref Seq Accession NM_026034
Chromosome Location 5
ENSEMBL Transcript ID ENSMUST00000072896
ENSEMBL Gene ID ENSMUSG00000038525
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 23
Template Well D04
Template Group  
Template Sequence Status Partial
Template Sequence ID 762540_r1AI595043BX5
TGU B
 Template Sequence