Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T2020
Clone ID E2020
Template ID T2020
Template Origin Plasmid
Clone Image 747775
Validity OK
Gene symbol Vac14
Gene description Vac14 homolog (S. cerevisiae) (Vac14)
Gene Aliases Trx, Tax1bp2, MGC38230, D8Wsu151e
MGI ID MGI:2157980
Entrez Gene ID 234729
Ref Seq Accession NM_146216
Chromosome Location 8
ENSEMBL Transcript ID ENSMUST00000042778
ENSEMBL Gene ID ENSMUSG00000010936
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 23
Template Well B08
Template Group  
Template Sequence Status Partial
Template Sequence ID 747775_r1AI644711BX5
TGU B
 Template Sequence