Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T2016
Clone ID E2016
Template ID T2016
Template Origin Plasmid
Clone Image 736759
Validity OK
Gene symbol Aqp3
Gene description aquaporin 3 (Aqp3)
Gene Aliases AQP-2
MGI ID MGI:1333777
Entrez Gene ID 11828
Ref Seq Accession NM_016689
Chromosome Location 4
ENSEMBL Transcript ID ENSMUST00000055327
ENSEMBL Gene ID ENSMUSG00000028435
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 23
Template Well B04
Template Group  
Template Sequence Status Partial
Template Sequence ID 736759_r1AI463895BX5
TGU B
 Template Sequence