Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1948
Clone ID E1948
Template ID T1948
Template Origin Plasmid
Clone Image 639263
Validity OK
Gene symbol Zranb1
Gene description zinc finger, RAN-binding domain containing 1 (Zranb1)
Gene Aliases Gm1956, Trabid, D7Wsu87e, 9330160G10Rik
MGI ID MGI:106441
Entrez Gene ID 360216
Ref Seq Accession NM_207302
Chromosome Location 7
ENSEMBL Transcript ID ENSMUST00000033265
ENSEMBL Gene ID ENSMUSG00000030967
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 22
Template Well D08
Template Group  
Template Sequence Status Partial
Template Sequence ID 639263_r1AI645951BX5
TGU B
 Template Sequence