Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T189
Clone ID E189
Template ID T189
Template Origin Plasmid
Clone Image 2647510
Validity OK
Gene symbol Cfi
Gene description complement component factor i (Cfi)
Gene Aliases  
MGI ID MGI:105937
Entrez Gene ID 12630
Ref Seq Accession NM_007686
Chromosome Location 3
ENSEMBL Transcript ID NA
ENSEMBL Gene ID NA
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate 3
Template Well A12
Template Group  
Template Sequence Status Partial
Template Sequence ID 2647510_r1AW230653BX
TGU M
 Template Sequence