Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1883
Clone ID E1883
Template ID T1883
Template Origin Plasmid
Clone Image 597306
Validity OK
Gene symbol Tap1
Gene description transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) (Tap1)
Gene Aliases Y3, TAP, APT1, Ham1, MTP1, PSF1, ABC17,
MGI ID MGI:98483
Entrez Gene ID 21354
Ref Seq Accession NM_013683
Chromosome Location 17
ENSEMBL Transcript ID ENSMUST00000041633
ENSEMBL Gene ID ENSMUSG00000037321
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 21
Template Well G03
Template Group  
Template Sequence Status Partial
Template Sequence ID 597306_r1AI324358BX5
TGU B
 Template Sequence