Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1827
Clone ID E1827
Template ID T1827
Template Origin Plasmid
Clone Image 577944
Validity OK
Gene symbol Nup43
Gene description nucleoporin 43 (Nup43)
Gene Aliases p42, 43kDa, 2610016K01Rik, 2610529I12Rik
MGI ID MGI:1917162
Entrez Gene ID 69912
Ref Seq Accession NM_145706
Chromosome Location 10
ENSEMBL Transcript ID ENSMUST00000040135
ENSEMBL Gene ID ENSMUSG00000040034
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 21
Template Well B07
Template Group  
Template Sequence Status Partial
Template Sequence ID 577944_r1AI510498BX5
TGU B
 Template Sequence