Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1781
Clone ID E1781
Template ID T1781
Template Origin Plasmid
Clone Image 571882
Validity OK
Gene symbol Atp1b1
Gene description ATPase, Na+/K+ transporting, beta 1 polypeptide (Atp1b1)
Gene Aliases Atpb, Atpb-1
MGI ID MGI:88108
Entrez Gene ID 11931
Ref Seq Accession NM_009721
Chromosome Location 1
ENSEMBL Transcript ID ENSMUST00000027863
ENSEMBL Gene ID ENSMUSG00000026576
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 20
Template Well F09
Template Group  
Template Sequence Status Partial
Template Sequence ID 571882_r1AI587809A11
TGU B
 Template Sequence