Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1779
Clone ID E1779
Template ID T1779
Template Origin Plasmid
Clone Image 570948
Validity OK
Gene symbol Atpaf1
Gene description ATP synthase mitochondrial F1 complex assembly factor 1 (Atpaf1)
Gene Aliases ATP11, ATP11p, 6330547J17Rik
MGI ID MGI:2180560
Entrez Gene ID 230649
Ref Seq Accession NM_181040
Chromosome Location 4
ENSEMBL Transcript ID ENSMUST00000030478
ENSEMBL Gene ID ENSMUSG00000028710
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 20
Template Well F07
Template Group  
Template Sequence Status Partial
Template Sequence ID 570948_r1AI587734BX5
TGU B
 Template Sequence