Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1734
Clone ID E1734
Template ID T1734
Template Origin Plasmid
Clone Image 480748
Validity OK
Gene symbol Art5
Gene description ADP-ribosyltransferase 5 (Art5)
Gene Aliases Yac-2
MGI ID MGI:107948
Entrez Gene ID 11875
Ref Seq Accession NM_007491
Chromosome Location 7
ENSEMBL Transcript ID ENSMUST00000080819
ENSEMBL Gene ID ENSMUSG00000061868
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 20
Template Well B10
Template Group  
Template Sequence Status Partial
Template Sequence ID 480748_r1AI323075BX5
TGU B
 Template Sequence