Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1733
Clone ID E1733
Template ID T1733
Template Origin Plasmid
Clone Image 480747
Validity OK
Gene symbol Zfp296
Gene description zinc finger protein 296 (Zfp296)
Gene Aliases 2210018A16Rik
MGI ID MGI:1926956
Entrez Gene ID 63872
Ref Seq Accession NM_022409
Chromosome Location 7
ENSEMBL Transcript ID NA
ENSEMBL Gene ID NA
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 20
Template Well B09
Template Group  
Template Sequence Status Partial
Template Sequence ID 480747_r1AI595458BX5
TGU B
 Template Sequence