Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T172
Clone ID E172
Template ID T172
Template Origin Plasmid
Clone Image 2646058
Validity OK
Gene symbol Card4
Gene description caspase recruitment domain 4 (Card4)
Gene Aliases Nod1, C230079P11, F830007N14Rik
MGI ID MGI:1341839
Entrez Gene ID 107607
Ref Seq Accession NM_172729
Chromosome Location 6
ENSEMBL Transcript ID ENSMUST00000060655
ENSEMBL Gene ID ENSMUSG00000038058
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate 2
Template Well H07
Template Group  
Template Sequence Status Partial
Template Sequence ID 2646058_r1AW322696BX
TGU M
 Template Sequence