Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1707
Clone ID E1707
Template ID T1707
Template Origin Plasmid
Clone Image 478158
Validity OK
Gene symbol Arrb2
Gene description arrestin, beta 2 (Arrb2)
Gene Aliases  
MGI ID MGI:99474
Entrez Gene ID 216869
Ref Seq Accession NM_145429
Chromosome Location 11
ENSEMBL Transcript ID ENSMUST00000079056
ENSEMBL Gene ID ENSMUSG00000060216
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 19
Template Well H07
Template Group  
Template Sequence Status Partial
Template Sequence ID 478158_r1AI322696BX5
TGU B
 Template Sequence