Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1682
Clone ID E1682
Template ID T1682
Template Origin Plasmid
Clone Image 475445
Validity OK
Gene symbol Nfe2
Gene description nuclear factor, erythroid derived 2 (Nfe2)
Gene Aliases p45, 45kDa, NF-E2, p45NFE2, p45nf-e2
MGI ID MGI:97308
Entrez Gene ID 18022
Ref Seq Accession NM_008685
Chromosome Location 15
ENSEMBL Transcript ID ENSMUST00000075192
ENSEMBL Gene ID ENSMUSG00000058794
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 19
Template Well F06
Template Group  
Template Sequence Status Partial
Template Sequence ID 475445_r1AI323017BX5
TGU B
 Template Sequence