Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1664
Clone ID E1664
Template ID T1664
Template Origin Plasmid
Clone Image 465511
Validity OK
Gene symbol 4432416J03Rik
Gene description RIKEN cDNA 4432416J03 gene (4432416J03Rik)
Gene Aliases  
MGI ID MGI:1925502
Entrez Gene ID 78252
Ref Seq Accession NM_030069
Chromosome Location 9
ENSEMBL Transcript ID ENSMUST00000034527
ENSEMBL Gene ID ENSMUSG00000032028
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 19
Template Well D12
Template Group  
Template Sequence Status Partial
Template Sequence ID 465511_r1BX520182A03
TGU B
 Template Sequence