Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1660
Clone ID E1660
Template ID T1660
Template Origin Plasmid
Clone Image 465060
Validity OK
Gene symbol Trim10
Gene description tripartite motif protein 10 (Trim10)
Gene Aliases Rnf9, Herf1
MGI ID MGI:1338757
Entrez Gene ID 19824
Ref Seq Accession NM_011280
Chromosome Location 17
ENSEMBL Transcript ID ENSMUST00000060524
ENSEMBL Gene ID ENSMUSG00000052980
ENSEMBL version  
Vector (Plasmid) pT7T3D-PacI
AntiSense Promoter T3
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 19
Template Well D08
Template Group  
Template Sequence Status Partial
Template Sequence ID 465060_r1AI322549BX5
TGU B
 Template Sequence