Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1585
Clone ID E1585
Template ID T1585
Template Origin Plasmid
Clone Image 945686
Validity OK
Gene symbol Ascc2
Gene description activating signal cointegrator 1 complex subunit 2 (Ascc2)
Gene Aliases ASC1p100, FLJ21588, 1700011I11Rik, 2610034L15Rik
MGI ID MGI:1922702
Entrez Gene ID 75452
Ref Seq Accession NM_029291
Chromosome Location 11
ENSEMBL Transcript ID ENSMUST00000070257
ENSEMBL Gene ID ENSMUSG00000020412
ENSEMBL version  
Vector (Plasmid) pSPORT1
AntiSense Promoter Sp6
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 17
Template Well H12
Template Group  
Template Sequence Status Partial
Template Sequence ID 945686_r1AA546188AI5
TGU B
 Template Sequence