Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T158
Clone ID E158
Template ID T158
Template Origin Plasmid
Clone Image 2631233
Validity OK
Gene symbol Slc16a3
Gene description solute carrier family 16 (monocarboxylic acid transporters), member 3 (Slc16a3)
Gene Aliases Mct3, Mct4
MGI ID MGI:1933438
Entrez Gene ID 80879
Ref Seq Accession NM_030696
Chromosome Location 11
ENSEMBL Transcript ID ENSMUST00000070653
ENSEMBL Gene ID ENSMUSG00000025161
ENSEMBL version  
Vector (Plasmid) pCMV-SPORT6
AntiSense Promoter T7
Sense Promoter Sp6
Forward Primer RZPD T7
Forward Primer Sequences TAATACGACTCACTATAGGG
Reverse Primer RZPD sp6
Reverse Primer Sequences ATTTAGGTGACACTATAG
Template Plate 2
Template Well G05
Template Group  
Template Sequence Status Partial
Template Sequence ID 2631233_r1BX528254AW
TGU M
 Template Sequence