Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1570
Clone ID E1570
Template ID T1570
Template Origin Plasmid
Clone Image 933209
Validity OK
Gene symbol Zfp451
Gene description zinc finger protein 451 (Zfp451)
Gene Aliases COASTER, mKIAA1702, Kiaa0576-hp, 4930515K21Rik, 4933435G09Rik
MGI ID MGI:2137896
Entrez Gene ID 98403
Ref Seq Accession NM_133817
Chromosome Location 1
ENSEMBL Transcript ID ENSMUST00000019861
ENSEMBL Gene ID ENSMUSG00000042197
ENSEMBL version  
Vector (Plasmid) pSPORT1
AntiSense Promoter Sp6
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 17
Template Well G09
Template Group  
Template Sequence Status Partial
Template Sequence ID 933209_r1AI585400BX5
TGU B
 Template Sequence