Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1563
Clone ID E1563
Template ID T1563
Template Origin Plasmid
Clone Image 907410
Validity OK
Gene symbol Utp14a
Gene description UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast) (Utp14a)
Gene Aliases MGC, JsdX, NY-CO-16, SDCCAG16, mKIAA0266, 2700066J21Rik
MGI ID MGI:1919804
Entrez Gene ID 72554
Ref Seq Accession NM_028276
Chromosome Location X
ENSEMBL Transcript ID NA
ENSEMBL Gene ID NA
ENSEMBL version  
Vector (Plasmid) pSPORT1
AntiSense Promoter Sp6
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 17
Template Well G02
Template Group  
Template Sequence Status Partial
Template Sequence ID 907410_r1AA591341BX5
TGU B
 Template Sequence