Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1559
Clone ID E1559
Template ID T1559
Template Origin Plasmid
Clone Image 906689
Validity OK
Gene symbol Wrnip1
Gene description Werner helicase interacting protein 1 (Wrnip1)
Gene Aliases WHIP, Wrnip, 4833444L21Rik
MGI ID MGI:1926153
Entrez Gene ID 78903
Ref Seq Accession NM_030215
Chromosome Location 13
ENSEMBL Transcript ID ENSMUST00000021832
ENSEMBL Gene ID ENSMUSG00000021400
ENSEMBL version  
Vector (Plasmid) pSPORT1
AntiSense Promoter Sp6
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 17
Template Well F10
Template Group  
Template Sequence Status Partial
Template Sequence ID 906689_r1AI551927BX5
TGU B
 Template Sequence