Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1542
Clone ID E1542
Template ID T1542
Template Origin Plasmid
Clone Image 834517
Validity OK
Gene symbol 2900024C23Rik
Gene description RIKEN cDNA 2900024C23 gene (2900024C23Rik)
Gene Aliases  
MGI ID MGI:1914516
Entrez Gene ID 67266
Ref Seq Accession NM_026062
Chromosome Location 5
ENSEMBL Transcript ID ENSMUST00000031198
ENSEMBL Gene ID ENSMUSG00000029270
ENSEMBL version  
Vector (Plasmid) pSPORT1
AntiSense Promoter Sp6
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 17
Template Well E05
Template Group  
Template Sequence Status Partial
Template Sequence ID 834517_r1AI596529BX5
TGU B
 Template Sequence