Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1514
Clone ID E1514
Template ID T1514
Template Origin Plasmid
Clone Image 761247
Validity OK
Gene symbol BC027231
Gene description cDNA sequence BC027231 (BC027231)
Gene Aliases MGC27931
MGI ID MGI:2384836
Entrez Gene ID 212547
Ref Seq Accession NM_145972
Chromosome Location 16
ENSEMBL Transcript ID ENSMUST00000048788
ENSEMBL Gene ID ENSMUSG00000036208
ENSEMBL version  
Vector (Plasmid) pSPORT1
AntiSense Promoter Sp6
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 17
Template Well C01
Template Group  
Template Sequence Status Partial
Template Sequence ID 761247_r1AI509020BX5
TGU B
 Template Sequence