Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1493
Clone ID E1493
Template ID T1493
Template Origin Plasmid
Clone Image 537975
Validity OK
Gene symbol Arntl
Gene description aryl hydrocarbon receptor nuclear translocator-like (Arntl)
Gene Aliases MOP3, Arnt3, Bmal1, BMAL1b, bmal1b'
MGI ID MGI:1096381
Entrez Gene ID 11865
Ref Seq Accession NM_007489
Chromosome Location 7
ENSEMBL Transcript ID ENSMUST00000047321
ENSEMBL Gene ID ENSMUSG00000055116
ENSEMBL version  
Vector (Plasmid) pSPORT1
AntiSense Promoter Sp6
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 17
Template Well A04
Template Group  
Template Sequence Status Partial
Template Sequence ID 537975_r1AI550145A11
TGU B
 Template Sequence