Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1492
Clone ID E1492
Template ID T1492
Template Origin Plasmid
Clone Image 537684
Validity OK
Gene symbol Lrdd
Gene description leucine-rich and death domain containing (Lrdd)
Gene Aliases Pidd, 1200011D09Rik
MGI ID MGI:1889507
Entrez Gene ID 57913
Ref Seq Accession NM_022654
Chromosome Location 7
ENSEMBL Transcript ID ENSMUST00000026580
ENSEMBL Gene ID ENSMUSG00000025507
ENSEMBL version  
Vector (Plasmid) pSPORT1
AntiSense Promoter Sp6
Sense Promoter T7
Forward Primer RZPD M13 forward
Forward Primer Sequences GCTATTACGCCAGCTGGCGAAAGGGGGATGTG
Reverse Primer RZPD M13 reverse
Reverse Primer Sequences CCCCAGGCTTTACACTTTATGCTTCCGGCTCG
Template Plate 17
Template Well A03
Template Group  
Template Sequence Status Partial
Template Sequence ID 537684_r1AI550128A11
TGU B
 Template Sequence