Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1472
Clone ID E1472
Template ID T1472
Template Origin Plasmid
Clone Image 2537004
Validity OK
Gene symbol Atp6v1b1
Gene description ATPase, H+ transporting, V1 subunit B, isoform 1 (Atp6v1b1)
Gene Aliases Vpp3, Vpp-3, Atp6b1, D630003L15, D630039P21Rik
MGI ID MGI:103285
Entrez Gene ID 110935
Ref Seq Accession NM_134157
Chromosome Location 6
ENSEMBL Transcript ID ENSMUST00000006431
ENSEMBL Gene ID ENSMUSG00000006269
ENSEMBL version  
Vector (Plasmid) pME18S-FL3
AntiSense Promoter T3
Sense Promoter T7
Forward Primer T7-pME18S-FL3-fw
Forward Primer Sequences CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG
Reverse Primer T3-pME18S-FL3-rv
Reverse Primer Sequences CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC
Template Plate 16
Template Well E07
Template Group  
Template Sequence Status Partial
Template Sequence ID 2537004_r1AW611178BX
TGU B
 Template Sequence