Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1439
Clone ID E1439
Template ID T1439
Template Origin Plasmid
Clone Image 2503323
Validity OK
Gene symbol Atp6v1e1
Gene description ATPase, H+ transporting, V1 subunit E isoform 1 (Atp6v1e1)
Gene Aliases E2, P31, Vma4, Atp6e, Atp6e2, Atp6v1e, D
MGI ID MGI:894326
Entrez Gene ID 11973
Ref Seq Accession NM_007510
Chromosome Location 6
ENSEMBL Transcript ID ENSMUST00000019354
ENSEMBL Gene ID ENSMUSG00000019210
ENSEMBL version  
Vector (Plasmid) pME18S-FL3
AntiSense Promoter T3
Sense Promoter T7
Forward Primer T7-pME18S-FL3-fw
Forward Primer Sequences CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG
Reverse Primer T3-pME18S-FL3-rv
Reverse Primer Sequences CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC
Template Plate 16
Template Well B10
Template Group  
Template Sequence Status Partial
Template Sequence ID 2503323_r1AW475262BX
TGU B
 Template Sequence