Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1414
Clone ID E1414
Template ID T1414
Template Origin Plasmid
Clone Image 2373235
Validity OK
Gene symbol Plscr2
Gene description phospholipid scramblase 2 (Plscr2)
Gene Aliases Plscr1
MGI ID MGI:1270860
Entrez Gene ID 18828
Ref Seq Accession NM_008880
Chromosome Location 9
ENSEMBL Transcript ID ENSMUST00000034932
ENSEMBL Gene ID ENSMUSG00000032372
ENSEMBL version  
Vector (Plasmid) pME18S-FL3
AntiSense Promoter T3
Sense Promoter T7
Forward Primer T7-pME18S-FL3-fw
Forward Primer Sequences CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG
Reverse Primer T3-pME18S-FL3-rv
Reverse Primer Sequences CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC
Template Plate 15
Template Well H09
Template Group  
Template Sequence Status Partial
Template Sequence ID 2373235_r1AW318850BX
TGU B
 Template Sequence