Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1323
Clone ID E1323
Template ID T1323
Template Origin Plasmid
Clone Image 2270265
Validity OK
Gene symbol 0610007C21Rik
Gene description RIKEN cDNA 0610007C21 gene (0610007C21Rik), transcript variant 1
Gene Aliases p18, Apr3, HSPC013
MGI ID MGI:1918918
Entrez Gene ID 381629
Ref Seq Accession NM_027855
Chromosome Location 5
ENSEMBL Transcript ID ENSMUST00000013766
ENSEMBL Gene ID ENSMUSG00000013622
ENSEMBL version  
Vector (Plasmid) pME18S-FL3
AntiSense Promoter T3
Sense Promoter T7
Forward Primer T7-pME18S-FL3-fw
Forward Primer Sequences CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG
Reverse Primer T3-pME18S-FL3-rv
Reverse Primer Sequences CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC
Template Plate 15
Template Well A02
Template Group  
Template Sequence Status Partial
Template Sequence ID 2270265_r1AW226655BX
TGU B
 Template Sequence