Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1322
Clone ID E1322
Template ID T1322
Template Origin Plasmid
Clone Image 2270207
Validity OK
Gene symbol AW209491
Gene description expressed sequence AW209491 (AW209491)
Gene Aliases  
MGI ID MGI:2145422
Entrez Gene ID 105351
Ref Seq Accession NM_134067
Chromosome Location 13
ENSEMBL Transcript ID ENSMUST00000038690
ENSEMBL Gene ID ENSMUSG00000039182
ENSEMBL version  
Vector (Plasmid) pME18S-FL3
AntiSense Promoter T3
Sense Promoter T7
Forward Primer T7-pME18S-FL3-fw
Forward Primer Sequences CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG
Reverse Primer T3-pME18S-FL3-rv
Reverse Primer Sequences CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC
Template Plate 15
Template Well A01
Template Group  
Template Sequence Status Partial
Template Sequence ID 2270207_r1AW213621BX
TGU B
 Template Sequence