Eurexpress
A Transcriptome Atlas Database for Mouse Embryo
Old webpage   Quick Search:    for   
Quick Help:    Sitemap      Using Context Help  
Home > Databases > Template Information  

Eurexpress Template

Eurexpress Template ID: T1320
Clone ID E1320
Template ID T1320
Template Origin Plasmid
Clone Image 2270161
Validity OK
Gene symbol Efemp1
Gene description epidermal growth factor-containing fibulin-like extracellular matrix protein 1 (Efemp1)
Gene Aliases MGC37612
MGI ID MGI:1339998
Entrez Gene ID 216616
Ref Seq Accession NM_146015
Chromosome Location 11
ENSEMBL Transcript ID ENSMUST00000020759
ENSEMBL Gene ID ENSMUSG00000020467
ENSEMBL version  
Vector (Plasmid) pME18S-FL3
AntiSense Promoter T3
Sense Promoter T7
Forward Primer T7-pME18S-FL3-fw
Forward Primer Sequences CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG
Reverse Primer T3-pME18S-FL3-rv
Reverse Primer Sequences CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC
Template Plate 14
Template Well H11
Template Group  
Template Sequence Status Partial
Template Sequence ID 2270161_r1AW226633BX
TGU B
 Template Sequence